You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
gapB [2019-07-09 08:24:04]
glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH
Molecular weight
37.32 kDa
Function
anabolic enzyme in gluconeogenesis
Product
glyceraldehyde-3-phosphate dehydrogenase 2
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,967,032 → 2,968,054
Phenotypes of a mutant
inactivation of gapB reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells PubMed The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate + phosphate + NAD(P)+ = 3-phospho-D-glyceroyl phosphate + NAD(P)H (according to Swiss-Prot)This reaction is part of the gluconeogenesisProtein family
glyceraldehyde-3-phosphate dehydrogenase family (according to Swiss-Prot)Paralogous protein(s)
Kinetic information
Domains
Nucleotid bindinge domain (12-13)2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)Cofactors
NADP+ (preferentially) and NAD+ PubMed Structure
3PRL (from B. halodurans) Localization
Cytoplasm (Homogeneous) PubMed Additional information
degraded after a shift from malate to glucose with an estimated half-life time of approx. 3 hours by ClpC-ClpP PubMed Expression and Regulation
Operons
Sigma factors
Regulatory mechanism
Regulation
Additional information
'speD': the mRNA is substantially stabilized upon depletion of RNase Y (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) PubMed view in new tabBiological materials
Mutant
MGNA-A121 (gapB::erm), available at the NBRP B. subtilis, JapanGP701 (gapB::spec), available in Stülke lab1A1004 ( gapB::erm), [Pubmed| ], available at BGSCBKE29020 (ΔgapB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACACBKK29020 (ΔgapB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC Labs working on this gene/protein
References
Loading